ID: 1062197990

View in Genome Browser
Species Human (GRCh38)
Location 9:135285216-135285238
Sequence GCATGTGCACGTGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197990_1062197998 14 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062197998 9:135285253-135285275 AGGCATGTGCACACGTGACACGG No data
1062197990_1062198000 23 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197990_1062197992 -6 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197990_1062197999 15 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062197999 9:135285254-135285276 GGCATGTGCACACGTGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197990 Original CRISPR GCATGTGCACGTGTGTGCCT GGG (reversed) Intergenic
No off target data available for this crispr