ID: 1062197992

View in Genome Browser
Species Human (GRCh38)
Location 9:135285233-135285255
Sequence ACATGCATCCCCCCACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197991_1062197992 -7 Left 1062197991 9:135285217-135285239 CCAGGCACACACGTGCACATGCA No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197984_1062197992 29 Left 1062197984 9:135285181-135285203 CCCCCACACAGGCATGTGCACAC No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197985_1062197992 28 Left 1062197985 9:135285182-135285204 CCCCACACAGGCATGTGCACACG No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197987_1062197992 26 Left 1062197987 9:135285184-135285206 CCACACAGGCATGTGCACACGTG No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197986_1062197992 27 Left 1062197986 9:135285183-135285205 CCCACACAGGCATGTGCACACGT No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197989_1062197992 -5 Left 1062197989 9:135285215-135285237 CCCCAGGCACACACGTGCACATG No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data
1062197990_1062197992 -6 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062197992 9:135285233-135285255 ACATGCATCCCCCCACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197992 Original CRISPR ACATGCATCCCCCCACACAC AGG Intergenic
No off target data available for this crispr