ID: 1062197998

View in Genome Browser
Species Human (GRCh38)
Location 9:135285253-135285275
Sequence AGGCATGTGCACACGTGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197991_1062197998 13 Left 1062197991 9:135285217-135285239 CCAGGCACACACGTGCACATGCA No data
Right 1062197998 9:135285253-135285275 AGGCATGTGCACACGTGACACGG No data
1062197989_1062197998 15 Left 1062197989 9:135285215-135285237 CCCCAGGCACACACGTGCACATG No data
Right 1062197998 9:135285253-135285275 AGGCATGTGCACACGTGACACGG No data
1062197990_1062197998 14 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062197998 9:135285253-135285275 AGGCATGTGCACACGTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197998 Original CRISPR AGGCATGTGCACACGTGACA CGG Intergenic
No off target data available for this crispr