ID: 1062197999

View in Genome Browser
Species Human (GRCh38)
Location 9:135285254-135285276
Sequence GGCATGTGCACACGTGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197991_1062197999 14 Left 1062197991 9:135285217-135285239 CCAGGCACACACGTGCACATGCA No data
Right 1062197999 9:135285254-135285276 GGCATGTGCACACGTGACACGGG No data
1062197989_1062197999 16 Left 1062197989 9:135285215-135285237 CCCCAGGCACACACGTGCACATG No data
Right 1062197999 9:135285254-135285276 GGCATGTGCACACGTGACACGGG No data
1062197993_1062197999 -10 Left 1062197993 9:135285241-135285263 CCCCCCACACACAGGCATGTGCA No data
Right 1062197999 9:135285254-135285276 GGCATGTGCACACGTGACACGGG No data
1062197990_1062197999 15 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062197999 9:135285254-135285276 GGCATGTGCACACGTGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062197999 Original CRISPR GGCATGTGCACACGTGACAC GGG Intergenic
No off target data available for this crispr