ID: 1062198000

View in Genome Browser
Species Human (GRCh38)
Location 9:135285262-135285284
Sequence CACACGTGACACGGGTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062197991_1062198000 22 Left 1062197991 9:135285217-135285239 CCAGGCACACACGTGCACATGCA No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197996_1062198000 -5 Left 1062197996 9:135285244-135285266 CCCACACACAGGCATGTGCACAC No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197990_1062198000 23 Left 1062197990 9:135285216-135285238 CCCAGGCACACACGTGCACATGC No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197997_1062198000 -6 Left 1062197997 9:135285245-135285267 CCACACACAGGCATGTGCACACG No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197995_1062198000 -4 Left 1062197995 9:135285243-135285265 CCCCACACACAGGCATGTGCACA No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197989_1062198000 24 Left 1062197989 9:135285215-135285237 CCCCAGGCACACACGTGCACATG No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197994_1062198000 -3 Left 1062197994 9:135285242-135285264 CCCCCACACACAGGCATGTGCAC No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data
1062197993_1062198000 -2 Left 1062197993 9:135285241-135285263 CCCCCCACACACAGGCATGTGCA No data
Right 1062198000 9:135285262-135285284 CACACGTGACACGGGTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062198000 Original CRISPR CACACGTGACACGGGTCCCC AGG Intergenic
No off target data available for this crispr