ID: 1062198083

View in Genome Browser
Species Human (GRCh38)
Location 9:135285717-135285739
Sequence GCGTGTGCACGTGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062198083_1062198093 30 Left 1062198083 9:135285717-135285739 CCCAGGCACACACGTGCACACGC No data
Right 1062198093 9:135285770-135285792 ACATGCGTCCCTAGGCACATAGG No data
1062198083_1062198092 22 Left 1062198083 9:135285717-135285739 CCCAGGCACACACGTGCACACGC No data
Right 1062198092 9:135285762-135285784 CACACGTGACATGCGTCCCTAGG No data
1062198083_1062198085 -7 Left 1062198083 9:135285717-135285739 CCCAGGCACACACGTGCACACGC No data
Right 1062198085 9:135285733-135285755 CACACGCATCCCCCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062198083 Original CRISPR GCGTGTGCACGTGTGTGCCT GGG (reversed) Intergenic
No off target data available for this crispr