ID: 1062198331

View in Genome Browser
Species Human (GRCh38)
Location 9:135287030-135287052
Sequence CCTTGGGCCGGAGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062198331_1062198349 24 Left 1062198331 9:135287030-135287052 CCCAGAGCAGCTCCGGCCCAAGG No data
Right 1062198349 9:135287077-135287099 GGGGCCCAGCACTGCCTCCTGGG No data
1062198331_1062198345 5 Left 1062198331 9:135287030-135287052 CCCAGAGCAGCTCCGGCCCAAGG No data
Right 1062198345 9:135287058-135287080 AAGGAGCAGCCGAGGACCTGGGG No data
1062198331_1062198344 4 Left 1062198331 9:135287030-135287052 CCCAGAGCAGCTCCGGCCCAAGG No data
Right 1062198344 9:135287057-135287079 CAAGGAGCAGCCGAGGACCTGGG No data
1062198331_1062198348 23 Left 1062198331 9:135287030-135287052 CCCAGAGCAGCTCCGGCCCAAGG No data
Right 1062198348 9:135287076-135287098 TGGGGCCCAGCACTGCCTCCTGG No data
1062198331_1062198343 3 Left 1062198331 9:135287030-135287052 CCCAGAGCAGCTCCGGCCCAAGG No data
Right 1062198343 9:135287056-135287078 CCAAGGAGCAGCCGAGGACCTGG No data
1062198331_1062198340 -3 Left 1062198331 9:135287030-135287052 CCCAGAGCAGCTCCGGCCCAAGG No data
Right 1062198340 9:135287050-135287072 AGGGGCCCAAGGAGCAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062198331 Original CRISPR CCTTGGGCCGGAGCTGCTCT GGG (reversed) Intergenic