ID: 1062199417

View in Genome Browser
Species Human (GRCh38)
Location 9:135293823-135293845
Sequence CTGTACAAACAGCTGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062199410_1062199417 8 Left 1062199410 9:135293792-135293814 CCCTATCAAGCTCTCCTGACGAC No data
Right 1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG No data
1062199409_1062199417 23 Left 1062199409 9:135293777-135293799 CCAAGCTGGGAAGGTCCCTATCA No data
Right 1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG No data
1062199412_1062199417 -6 Left 1062199412 9:135293806-135293828 CCTGACGACTGAGACAGCTGTAC No data
Right 1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG No data
1062199407_1062199417 27 Left 1062199407 9:135293773-135293795 CCGCCCAAGCTGGGAAGGTCCCT No data
Right 1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG No data
1062199411_1062199417 7 Left 1062199411 9:135293793-135293815 CCTATCAAGCTCTCCTGACGACT No data
Right 1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG No data
1062199408_1062199417 24 Left 1062199408 9:135293776-135293798 CCCAAGCTGGGAAGGTCCCTATC No data
Right 1062199417 9:135293823-135293845 CTGTACAAACAGCTGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062199417 Original CRISPR CTGTACAAACAGCTGGATGG GGG Intergenic
No off target data available for this crispr