ID: 1062200684

View in Genome Browser
Species Human (GRCh38)
Location 9:135301183-135301205
Sequence TGCCAGCTAGAGTCCCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062200682_1062200684 -10 Left 1062200682 9:135301170-135301192 CCCTGAGCAAAGTTGCCAGCTAG No data
Right 1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG No data
1062200681_1062200684 -4 Left 1062200681 9:135301164-135301186 CCGGGTCCCTGAGCAAAGTTGCC No data
Right 1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG No data
1062200677_1062200684 30 Left 1062200677 9:135301130-135301152 CCTGGCTGGTGTGTATAAAGTAA No data
Right 1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG No data
1062200680_1062200684 3 Left 1062200680 9:135301157-135301179 CCAAAATCCGGGTCCCTGAGCAA No data
Right 1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062200684 Original CRISPR TGCCAGCTAGAGTCCCCCTG TGG Intergenic
No off target data available for this crispr