ID: 1062203694

View in Genome Browser
Species Human (GRCh38)
Location 9:135322874-135322896
Sequence CAATGAGTATCAAGTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062203694_1062203701 7 Left 1062203694 9:135322874-135322896 CCCAAGGAACTTGATACTCATTG No data
Right 1062203701 9:135322904-135322926 GTCTGTGAGGACCACCCTTGGGG No data
1062203694_1062203700 6 Left 1062203694 9:135322874-135322896 CCCAAGGAACTTGATACTCATTG No data
Right 1062203700 9:135322903-135322925 GGTCTGTGAGGACCACCCTTGGG No data
1062203694_1062203697 -6 Left 1062203694 9:135322874-135322896 CCCAAGGAACTTGATACTCATTG No data
Right 1062203697 9:135322891-135322913 TCATTGCAACCAGGTCTGTGAGG No data
1062203694_1062203699 5 Left 1062203694 9:135322874-135322896 CCCAAGGAACTTGATACTCATTG No data
Right 1062203699 9:135322902-135322924 AGGTCTGTGAGGACCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062203694 Original CRISPR CAATGAGTATCAAGTTCCTT GGG (reversed) Intergenic
No off target data available for this crispr