ID: 1062203700

View in Genome Browser
Species Human (GRCh38)
Location 9:135322903-135322925
Sequence GGTCTGTGAGGACCACCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062203694_1062203700 6 Left 1062203694 9:135322874-135322896 CCCAAGGAACTTGATACTCATTG No data
Right 1062203700 9:135322903-135322925 GGTCTGTGAGGACCACCCTTGGG No data
1062203695_1062203700 5 Left 1062203695 9:135322875-135322897 CCAAGGAACTTGATACTCATTGC No data
Right 1062203700 9:135322903-135322925 GGTCTGTGAGGACCACCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062203700 Original CRISPR GGTCTGTGAGGACCACCCTT GGG Intergenic
No off target data available for this crispr