ID: 1062204482

View in Genome Browser
Species Human (GRCh38)
Location 9:135328604-135328626
Sequence TCCAGCTGGCCCCCAACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062204482_1062204497 24 Left 1062204482 9:135328604-135328626 CCCACAGTTGGGGGCCAGCTGGA No data
Right 1062204497 9:135328651-135328673 AAGACAGTGGAATGGGAGCAGGG No data
1062204482_1062204494 16 Left 1062204482 9:135328604-135328626 CCCACAGTTGGGGGCCAGCTGGA No data
Right 1062204494 9:135328643-135328665 GTTCTGAGAAGACAGTGGAATGG No data
1062204482_1062204496 23 Left 1062204482 9:135328604-135328626 CCCACAGTTGGGGGCCAGCTGGA No data
Right 1062204496 9:135328650-135328672 GAAGACAGTGGAATGGGAGCAGG No data
1062204482_1062204492 11 Left 1062204482 9:135328604-135328626 CCCACAGTTGGGGGCCAGCTGGA No data
Right 1062204492 9:135328638-135328660 CCCAGGTTCTGAGAAGACAGTGG No data
1062204482_1062204495 17 Left 1062204482 9:135328604-135328626 CCCACAGTTGGGGGCCAGCTGGA No data
Right 1062204495 9:135328644-135328666 TTCTGAGAAGACAGTGGAATGGG No data
1062204482_1062204487 -6 Left 1062204482 9:135328604-135328626 CCCACAGTTGGGGGCCAGCTGGA No data
Right 1062204487 9:135328621-135328643 GCTGGATTCCCAGGGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062204482 Original CRISPR TCCAGCTGGCCCCCAACTGT GGG (reversed) Intergenic
No off target data available for this crispr