ID: 1062205204

View in Genome Browser
Species Human (GRCh38)
Location 9:135332678-135332700
Sequence GAACCTCCATGCTCACACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062205196_1062205204 16 Left 1062205196 9:135332639-135332661 CCAGGCAGCCCTTGGCCTCTGCT No data
Right 1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG No data
1062205200_1062205204 1 Left 1062205200 9:135332654-135332676 CCTCTGCTCCTAGAGGCTGCCGT No data
Right 1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG No data
1062205197_1062205204 8 Left 1062205197 9:135332647-135332669 CCCTTGGCCTCTGCTCCTAGAGG No data
Right 1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG No data
1062205202_1062205204 -7 Left 1062205202 9:135332662-135332684 CCTAGAGGCTGCCGTGGAACCTC No data
Right 1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG No data
1062205199_1062205204 7 Left 1062205199 9:135332648-135332670 CCTTGGCCTCTGCTCCTAGAGGC No data
Right 1062205204 9:135332678-135332700 GAACCTCCATGCTCACACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062205204 Original CRISPR GAACCTCCATGCTCACACCT AGG Intergenic
No off target data available for this crispr