ID: 1062206513

View in Genome Browser
Species Human (GRCh38)
Location 9:135340552-135340574
Sequence TTTGGGGGCAGTGCAGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062206513_1062206521 18 Left 1062206513 9:135340552-135340574 CCCGCAGCTGCACTGCCCCCAAA No data
Right 1062206521 9:135340593-135340615 AAAAAATTAAATGAAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062206513 Original CRISPR TTTGGGGGCAGTGCAGCTGC GGG (reversed) Intergenic
No off target data available for this crispr