ID: 1062208918

View in Genome Browser
Species Human (GRCh38)
Location 9:135352773-135352795
Sequence ACGTTTGTCTGGAGAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062208918_1062208923 -2 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208923 9:135352794-135352816 GTCAGATGGGGCCCTTCTCCTGG No data
1062208918_1062208931 21 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208931 9:135352817-135352839 GACAAGGCCAGGGCCACCGCTGG No data
1062208918_1062208928 10 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208928 9:135352806-135352828 CCTTCTCCTGGGACAAGGCCAGG No data
1062208918_1062208924 -1 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208924 9:135352795-135352817 TCAGATGGGGCCCTTCTCCTGGG No data
1062208918_1062208925 5 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG No data
1062208918_1062208929 11 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208929 9:135352807-135352829 CTTCTCCTGGGACAAGGCCAGGG No data
1062208918_1062208932 22 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208932 9:135352818-135352840 ACAAGGCCAGGGCCACCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062208918 Original CRISPR ACGTTTGTCTGGAGAAGAAA AGG (reversed) Intergenic
No off target data available for this crispr