ID: 1062208925

View in Genome Browser
Species Human (GRCh38)
Location 9:135352801-135352823
Sequence GGGGCCCTTCTCCTGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062208922_1062208925 -6 Left 1062208922 9:135352784-135352806 CCAGACAAACGTCAGATGGGGCC No data
Right 1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG No data
1062208918_1062208925 5 Left 1062208918 9:135352773-135352795 CCTTTTCTTCTCCAGACAAACGT No data
Right 1062208925 9:135352801-135352823 GGGGCCCTTCTCCTGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062208925 Original CRISPR GGGGCCCTTCTCCTGGGACA AGG Intergenic
No off target data available for this crispr