ID: 1062210273

View in Genome Browser
Species Human (GRCh38)
Location 9:135359853-135359875
Sequence TCTGGGGCCCAGTAGAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062210273_1062210279 9 Left 1062210273 9:135359853-135359875 CCTGGATTCTACTGGGCCCCAGA No data
Right 1062210279 9:135359885-135359907 GAATCAACTCCTGTTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062210273 Original CRISPR TCTGGGGCCCAGTAGAATCC AGG (reversed) Intergenic
No off target data available for this crispr