ID: 1062211042

View in Genome Browser
Species Human (GRCh38)
Location 9:135364266-135364288
Sequence CTTGCCGTTTCCAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062211042_1062211049 21 Left 1062211042 9:135364266-135364288 CCTGCCTCCCTGGAAACGGCAAG No data
Right 1062211049 9:135364310-135364332 GAGCGCTCAGCGAGTGCTCAGGG No data
1062211042_1062211050 25 Left 1062211042 9:135364266-135364288 CCTGCCTCCCTGGAAACGGCAAG No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data
1062211042_1062211048 20 Left 1062211042 9:135364266-135364288 CCTGCCTCCCTGGAAACGGCAAG No data
Right 1062211048 9:135364309-135364331 TGAGCGCTCAGCGAGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062211042 Original CRISPR CTTGCCGTTTCCAGGGAGGC AGG (reversed) Intergenic