ID: 1062211043

View in Genome Browser
Species Human (GRCh38)
Location 9:135364270-135364292
Sequence TGTTCTTGCCGTTTCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062211043_1062211049 17 Left 1062211043 9:135364270-135364292 CCTCCCTGGAAACGGCAAGAACA No data
Right 1062211049 9:135364310-135364332 GAGCGCTCAGCGAGTGCTCAGGG No data
1062211043_1062211048 16 Left 1062211043 9:135364270-135364292 CCTCCCTGGAAACGGCAAGAACA No data
Right 1062211048 9:135364309-135364331 TGAGCGCTCAGCGAGTGCTCAGG No data
1062211043_1062211050 21 Left 1062211043 9:135364270-135364292 CCTCCCTGGAAACGGCAAGAACA No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062211043 Original CRISPR TGTTCTTGCCGTTTCCAGGG AGG (reversed) Intergenic