ID: 1062211044

View in Genome Browser
Species Human (GRCh38)
Location 9:135364273-135364295
Sequence TCTTGTTCTTGCCGTTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062211044_1062211050 18 Left 1062211044 9:135364273-135364295 CCCTGGAAACGGCAAGAACAAGA No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data
1062211044_1062211048 13 Left 1062211044 9:135364273-135364295 CCCTGGAAACGGCAAGAACAAGA No data
Right 1062211048 9:135364309-135364331 TGAGCGCTCAGCGAGTGCTCAGG No data
1062211044_1062211049 14 Left 1062211044 9:135364273-135364295 CCCTGGAAACGGCAAGAACAAGA No data
Right 1062211049 9:135364310-135364332 GAGCGCTCAGCGAGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062211044 Original CRISPR TCTTGTTCTTGCCGTTTCCA GGG (reversed) Intergenic