ID: 1062211045

View in Genome Browser
Species Human (GRCh38)
Location 9:135364274-135364296
Sequence CTCTTGTTCTTGCCGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062211045_1062211049 13 Left 1062211045 9:135364274-135364296 CCTGGAAACGGCAAGAACAAGAG No data
Right 1062211049 9:135364310-135364332 GAGCGCTCAGCGAGTGCTCAGGG No data
1062211045_1062211048 12 Left 1062211045 9:135364274-135364296 CCTGGAAACGGCAAGAACAAGAG No data
Right 1062211048 9:135364309-135364331 TGAGCGCTCAGCGAGTGCTCAGG No data
1062211045_1062211050 17 Left 1062211045 9:135364274-135364296 CCTGGAAACGGCAAGAACAAGAG No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062211045 Original CRISPR CTCTTGTTCTTGCCGTTTCC AGG (reversed) Intergenic