ID: 1062211047

View in Genome Browser
Species Human (GRCh38)
Location 9:135364278-135364300
Sequence GAAACGGCAAGAACAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062211041_1062211047 -10 Left 1062211041 9:135364265-135364287 CCCTGCCTCCCTGGAAACGGCAA No data
Right 1062211047 9:135364278-135364300 GAAACGGCAAGAACAAGAGGAGG No data
1062211036_1062211047 26 Left 1062211036 9:135364229-135364251 CCTCAGTGTTCTCACCTATAAAA No data
Right 1062211047 9:135364278-135364300 GAAACGGCAAGAACAAGAGGAGG No data
1062211038_1062211047 12 Left 1062211038 9:135364243-135364265 CCTATAAAATGGAGAAAATCTTC No data
Right 1062211047 9:135364278-135364300 GAAACGGCAAGAACAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062211047 Original CRISPR GAAACGGCAAGAACAAGAGG AGG Intergenic