ID: 1062211050

View in Genome Browser
Species Human (GRCh38)
Location 9:135364314-135364336
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062211043_1062211050 21 Left 1062211043 9:135364270-135364292 CCTCCCTGGAAACGGCAAGAACA No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data
1062211044_1062211050 18 Left 1062211044 9:135364273-135364295 CCCTGGAAACGGCAAGAACAAGA No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data
1062211042_1062211050 25 Left 1062211042 9:135364266-135364288 CCTGCCTCCCTGGAAACGGCAAG No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data
1062211045_1062211050 17 Left 1062211045 9:135364274-135364296 CCTGGAAACGGCAAGAACAAGAG No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data
1062211041_1062211050 26 Left 1062211041 9:135364265-135364287 CCCTGCCTCCCTGGAAACGGCAA No data
Right 1062211050 9:135364314-135364336 GCTCAGCGAGTGCTCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062211050 Original CRISPR GCTCAGCGAGTGCTCAGGGA AGG Intergenic