ID: 1062213261

View in Genome Browser
Species Human (GRCh38)
Location 9:135375955-135375977
Sequence TCCTCAAAGCCGTGAGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062213261_1062213267 27 Left 1062213261 9:135375955-135375977 CCTCTTGCTCACGGCTTTGAGGA No data
Right 1062213267 9:135376005-135376027 GCTGTCTGCTCCGAGCACGCAGG No data
1062213261_1062213268 30 Left 1062213261 9:135375955-135375977 CCTCTTGCTCACGGCTTTGAGGA No data
Right 1062213268 9:135376008-135376030 GTCTGCTCCGAGCACGCAGGTGG No data
1062213261_1062213262 -2 Left 1062213261 9:135375955-135375977 CCTCTTGCTCACGGCTTTGAGGA No data
Right 1062213262 9:135375976-135375998 GATGATAACGCCACCAATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062213261 Original CRISPR TCCTCAAAGCCGTGAGCAAG AGG (reversed) Intergenic
No off target data available for this crispr