ID: 1062213264

View in Genome Browser
Species Human (GRCh38)
Location 9:135375989-135376011
Sequence AGACAGCACAGGGCCGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062213264_1062213268 -4 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213268 9:135376008-135376030 GTCTGCTCCGAGCACGCAGGTGG No data
1062213264_1062213270 1 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213270 9:135376013-135376035 CTCCGAGCACGCAGGTGGGATGG No data
1062213264_1062213274 16 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213274 9:135376028-135376050 TGGGATGGGGAAGCTGAACTTGG No data
1062213264_1062213269 -3 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213269 9:135376009-135376031 TCTGCTCCGAGCACGCAGGTGGG No data
1062213264_1062213275 20 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG No data
1062213264_1062213276 25 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data
1062213264_1062213271 2 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213271 9:135376014-135376036 TCCGAGCACGCAGGTGGGATGGG No data
1062213264_1062213273 3 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213273 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
1062213264_1062213267 -7 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213267 9:135376005-135376027 GCTGTCTGCTCCGAGCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062213264 Original CRISPR AGACAGCACAGGGCCGAGAT TGG (reversed) Intergenic
No off target data available for this crispr