ID: 1062213265

View in Genome Browser
Species Human (GRCh38)
Location 9:135375999-135376021
Sequence TGCTCGGAGCAGACAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062213265_1062213271 -8 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213271 9:135376014-135376036 TCCGAGCACGCAGGTGGGATGGG No data
1062213265_1062213275 10 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG No data
1062213265_1062213273 -7 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213273 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
1062213265_1062213276 15 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data
1062213265_1062213274 6 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213274 9:135376028-135376050 TGGGATGGGGAAGCTGAACTTGG No data
1062213265_1062213270 -9 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213270 9:135376013-135376035 CTCCGAGCACGCAGGTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062213265 Original CRISPR TGCTCGGAGCAGACAGCACA GGG (reversed) Intergenic
No off target data available for this crispr