ID: 1062213268

View in Genome Browser
Species Human (GRCh38)
Location 9:135376008-135376030
Sequence GTCTGCTCCGAGCACGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062213264_1062213268 -4 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213268 9:135376008-135376030 GTCTGCTCCGAGCACGCAGGTGG No data
1062213263_1062213268 -1 Left 1062213263 9:135375986-135376008 CCACCAATCTCGGCCCTGTGCTG No data
Right 1062213268 9:135376008-135376030 GTCTGCTCCGAGCACGCAGGTGG No data
1062213261_1062213268 30 Left 1062213261 9:135375955-135375977 CCTCTTGCTCACGGCTTTGAGGA No data
Right 1062213268 9:135376008-135376030 GTCTGCTCCGAGCACGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062213268 Original CRISPR GTCTGCTCCGAGCACGCAGG TGG Intergenic
No off target data available for this crispr