ID: 1062213272

View in Genome Browser
Species Human (GRCh38)
Location 9:135376015-135376037
Sequence CCCCATCCCACCTGCGTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062213272_1062213279 23 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213279 9:135376061-135376083 TGAACTTGCTAGAAGAGACTGGG No data
1062213272_1062213278 22 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213278 9:135376060-135376082 CTGAACTTGCTAGAAGAGACTGG No data
1062213272_1062213275 -6 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213275 9:135376032-135376054 ATGGGGAAGCTGAACTTGGACGG No data
1062213272_1062213274 -10 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213274 9:135376028-135376050 TGGGATGGGGAAGCTGAACTTGG No data
1062213272_1062213280 24 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213280 9:135376062-135376084 GAACTTGCTAGAAGAGACTGGGG No data
1062213272_1062213276 -1 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062213272 Original CRISPR CCCCATCCCACCTGCGTGCT CGG (reversed) Intergenic
No off target data available for this crispr