ID: 1062213276

View in Genome Browser
Species Human (GRCh38)
Location 9:135376037-135376059
Sequence GAAGCTGAACTTGGACGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062213272_1062213276 -1 Left 1062213272 9:135376015-135376037 CCGAGCACGCAGGTGGGATGGGG No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data
1062213266_1062213276 14 Left 1062213266 9:135376000-135376022 CCTGTGCTGTCTGCTCCGAGCAC No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data
1062213265_1062213276 15 Left 1062213265 9:135375999-135376021 CCCTGTGCTGTCTGCTCCGAGCA No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data
1062213263_1062213276 28 Left 1062213263 9:135375986-135376008 CCACCAATCTCGGCCCTGTGCTG No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data
1062213264_1062213276 25 Left 1062213264 9:135375989-135376011 CCAATCTCGGCCCTGTGCTGTCT No data
Right 1062213276 9:135376037-135376059 GAAGCTGAACTTGGACGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062213276 Original CRISPR GAAGCTGAACTTGGACGGCC AGG Intergenic
No off target data available for this crispr