ID: 1062214160

View in Genome Browser
Species Human (GRCh38)
Location 9:135380041-135380063
Sequence CTGTGTCAGTGCCAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062214152_1062214160 -4 Left 1062214152 9:135380022-135380044 CCCTCCATCCTCATGCCCACTGT No data
Right 1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG No data
1062214149_1062214160 15 Left 1062214149 9:135380003-135380025 CCATCTCAGCCACCATGGTCCCT No data
Right 1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG No data
1062214154_1062214160 -8 Left 1062214154 9:135380026-135380048 CCATCCTCATGCCCACTGTGTCA No data
Right 1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG No data
1062214153_1062214160 -5 Left 1062214153 9:135380023-135380045 CCTCCATCCTCATGCCCACTGTG No data
Right 1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG No data
1062214151_1062214160 3 Left 1062214151 9:135380015-135380037 CCATGGTCCCTCCATCCTCATGC No data
Right 1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG No data
1062214150_1062214160 6 Left 1062214150 9:135380012-135380034 CCACCATGGTCCCTCCATCCTCA No data
Right 1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062214160 Original CRISPR CTGTGTCAGTGCCAGGTGGC AGG Intergenic
No off target data available for this crispr