ID: 1062215563

View in Genome Browser
Species Human (GRCh38)
Location 9:135387639-135387661
Sequence CAAGACAAGCAAGGGGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062215563_1062215572 10 Left 1062215563 9:135387639-135387661 CCTCCGTCCCCTTGCTTGTCTTG No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062215563 Original CRISPR CAAGACAAGCAAGGGGACGG AGG (reversed) Intergenic
No off target data available for this crispr