ID: 1062215572

View in Genome Browser
Species Human (GRCh38)
Location 9:135387672-135387694
Sequence CTGCTGCTGTCCTTGTTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062215562_1062215572 11 Left 1062215562 9:135387638-135387660 CCCTCCGTCCCCTTGCTTGTCTT No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data
1062215568_1062215572 3 Left 1062215568 9:135387646-135387668 CCCCTTGCTTGTCTTGGTTGGGA No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data
1062215563_1062215572 10 Left 1062215563 9:135387639-135387661 CCTCCGTCCCCTTGCTTGTCTTG No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data
1062215570_1062215572 1 Left 1062215570 9:135387648-135387670 CCTTGCTTGTCTTGGTTGGGAAA No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data
1062215565_1062215572 7 Left 1062215565 9:135387642-135387664 CCGTCCCCTTGCTTGTCTTGGTT No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data
1062215569_1062215572 2 Left 1062215569 9:135387647-135387669 CCCTTGCTTGTCTTGGTTGGGAA No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data
1062215561_1062215572 12 Left 1062215561 9:135387637-135387659 CCCCTCCGTCCCCTTGCTTGTCT No data
Right 1062215572 9:135387672-135387694 CTGCTGCTGTCCTTGTTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062215572 Original CRISPR CTGCTGCTGTCCTTGTTCCT CGG Intergenic
No off target data available for this crispr