ID: 1062217466

View in Genome Browser
Species Human (GRCh38)
Location 9:135397040-135397062
Sequence GGTCCCTGTGGACCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062217466_1062217480 13 Left 1062217466 9:135397040-135397062 CCAGCCTGGGGTCCACAGGGACC No data
Right 1062217480 9:135397076-135397098 CCGTGTGCTCAGGAAGAACCAGG No data
1062217466_1062217474 3 Left 1062217466 9:135397040-135397062 CCAGCCTGGGGTCCACAGGGACC No data
Right 1062217474 9:135397066-135397088 CCCAGGACCCCCGTGTGCTCAGG No data
1062217466_1062217482 25 Left 1062217466 9:135397040-135397062 CCAGCCTGGGGTCCACAGGGACC No data
Right 1062217482 9:135397088-135397110 GAAGAACCAGGGCCTGTTTGTGG No data
1062217466_1062217483 26 Left 1062217466 9:135397040-135397062 CCAGCCTGGGGTCCACAGGGACC No data
Right 1062217483 9:135397089-135397111 AAGAACCAGGGCCTGTTTGTGGG No data
1062217466_1062217481 14 Left 1062217466 9:135397040-135397062 CCAGCCTGGGGTCCACAGGGACC No data
Right 1062217481 9:135397077-135397099 CGTGTGCTCAGGAAGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062217466 Original CRISPR GGTCCCTGTGGACCCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr