ID: 1062218655

View in Genome Browser
Species Human (GRCh38)
Location 9:135402827-135402849
Sequence GAGAGGGTGGGCCTGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218655_1062218669 22 Left 1062218655 9:135402827-135402849 CCAGGCATCAGGCCCACCCTCTC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218655 Original CRISPR GAGAGGGTGGGCCTGATGCC TGG (reversed) Intergenic