ID: 1062218657

View in Genome Browser
Species Human (GRCh38)
Location 9:135402840-135402862
Sequence GCACGGAGGGTGGGAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218657_1062218677 27 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218677 9:135402890-135402912 ACCGGCCACCGAGGGCCCTGGGG No data
1062218657_1062218675 25 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218675 9:135402888-135402910 ACACCGGCCACCGAGGGCCCTGG No data
1062218657_1062218673 19 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
1062218657_1062218676 26 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218676 9:135402889-135402911 CACCGGCCACCGAGGGCCCTGGG No data
1062218657_1062218669 9 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218657_1062218671 18 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218671 9:135402881-135402903 GCCCTCAACACCGGCCACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218657 Original CRISPR GCACGGAGGGTGGGAGAGGG TGG (reversed) Intergenic