ID: 1062218662

View in Genome Browser
Species Human (GRCh38)
Location 9:135402853-135402875
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218662_1062218676 13 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218676 9:135402889-135402911 CACCGGCCACCGAGGGCCCTGGG No data
1062218662_1062218673 6 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
1062218662_1062218669 -4 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218662_1062218671 5 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218671 9:135402881-135402903 GCCCTCAACACCGGCCACCGAGG No data
1062218662_1062218675 12 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218675 9:135402888-135402910 ACACCGGCCACCGAGGGCCCTGG No data
1062218662_1062218677 14 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218677 9:135402890-135402912 ACCGGCCACCGAGGGCCCTGGGG No data
1062218662_1062218681 20 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218662_1062218683 23 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data
1062218662_1062218680 19 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218662 Original CRISPR GAGGCTGGAGGAGGCACGGA GGG (reversed) Intergenic