ID: 1062218665

View in Genome Browser
Species Human (GRCh38)
Location 9:135402862-135402884
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218665_1062218683 14 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data
1062218665_1062218671 -4 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218671 9:135402881-135402903 GCCCTCAACACCGGCCACCGAGG No data
1062218665_1062218676 4 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218676 9:135402889-135402911 CACCGGCCACCGAGGGCCCTGGG No data
1062218665_1062218673 -3 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
1062218665_1062218677 5 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218677 9:135402890-135402912 ACCGGCCACCGAGGGCCCTGGGG No data
1062218665_1062218681 11 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218665_1062218675 3 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218675 9:135402888-135402910 ACACCGGCCACCGAGGGCCCTGG No data
1062218665_1062218680 10 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218665 Original CRISPR GGGCTGATGGAGGCTGGAGG AGG (reversed) Intergenic