ID: 1062218666

View in Genome Browser
Species Human (GRCh38)
Location 9:135402865-135402887
Sequence TGAGGGCTGATGGAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218666_1062218677 2 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218677 9:135402890-135402912 ACCGGCCACCGAGGGCCCTGGGG No data
1062218666_1062218671 -7 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218671 9:135402881-135402903 GCCCTCAACACCGGCCACCGAGG No data
1062218666_1062218681 8 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG No data
1062218666_1062218680 7 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG No data
1062218666_1062218676 1 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218676 9:135402889-135402911 CACCGGCCACCGAGGGCCCTGGG No data
1062218666_1062218673 -6 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
1062218666_1062218683 11 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data
1062218666_1062218675 0 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218675 9:135402888-135402910 ACACCGGCCACCGAGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218666 Original CRISPR TGAGGGCTGATGGAGGCTGG AGG (reversed) Intergenic