ID: 1062218667

View in Genome Browser
Species Human (GRCh38)
Location 9:135402868-135402890
Sequence TGTTGAGGGCTGATGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218667_1062218680 4 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG No data
1062218667_1062218676 -2 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218676 9:135402889-135402911 CACCGGCCACCGAGGGCCCTGGG No data
1062218667_1062218677 -1 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218677 9:135402890-135402912 ACCGGCCACCGAGGGCCCTGGGG No data
1062218667_1062218681 5 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG No data
1062218667_1062218673 -9 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218673 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
1062218667_1062218671 -10 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218671 9:135402881-135402903 GCCCTCAACACCGGCCACCGAGG No data
1062218667_1062218683 8 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data
1062218667_1062218675 -3 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218675 9:135402888-135402910 ACACCGGCCACCGAGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218667 Original CRISPR TGTTGAGGGCTGATGGAGGC TGG (reversed) Intergenic