ID: 1062218669

View in Genome Browser
Species Human (GRCh38)
Location 9:135402872-135402894
Sequence CCTCCATCAGCCCTCAACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218655_1062218669 22 Left 1062218655 9:135402827-135402849 CCAGGCATCAGGCCCACCCTCTC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218658_1062218669 6 Left 1062218658 9:135402843-135402865 CCCTCTCCCACCCTCCGTGCCTC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218659_1062218669 5 Left 1062218659 9:135402844-135402866 CCTCTCCCACCCTCCGTGCCTCC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218663_1062218669 -5 Left 1062218663 9:135402854-135402876 CCTCCGTGCCTCCTCCAGCCTCC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218661_1062218669 -1 Left 1062218661 9:135402850-135402872 CCACCCTCCGTGCCTCCTCCAGC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218664_1062218669 -8 Left 1062218664 9:135402857-135402879 CCGTGCCTCCTCCAGCCTCCATC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218656_1062218669 10 Left 1062218656 9:135402839-135402861 CCCACCCTCTCCCACCCTCCGTG No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218660_1062218669 0 Left 1062218660 9:135402849-135402871 CCCACCCTCCGTGCCTCCTCCAG No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218657_1062218669 9 Left 1062218657 9:135402840-135402862 CCACCCTCTCCCACCCTCCGTGC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
1062218662_1062218669 -4 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218669 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218669 Original CRISPR CCTCCATCAGCCCTCAACAC CGG Intergenic