ID: 1062218670

View in Genome Browser
Species Human (GRCh38)
Location 9:135402875-135402897
Sequence TGGCCGGTGTTGAGGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218670_1062218677 -8 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218677 9:135402890-135402912 ACCGGCCACCGAGGGCCCTGGGG No data
1062218670_1062218675 -10 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218675 9:135402888-135402910 ACACCGGCCACCGAGGGCCCTGG No data
1062218670_1062218676 -9 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218676 9:135402889-135402911 CACCGGCCACCGAGGGCCCTGGG No data
1062218670_1062218683 1 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data
1062218670_1062218680 -3 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG No data
1062218670_1062218681 -2 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218670 Original CRISPR TGGCCGGTGTTGAGGGCTGA TGG (reversed) Intergenic