ID: 1062218672

View in Genome Browser
Species Human (GRCh38)
Location 9:135402882-135402904
Sequence CCCTCGGTGGCCGGTGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218672_1062218683 -6 Left 1062218672 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data
1062218672_1062218680 -10 Left 1062218672 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG No data
1062218672_1062218681 -9 Left 1062218672 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218672 Original CRISPR CCCTCGGTGGCCGGTGTTGA GGG (reversed) Intergenic