ID: 1062218674

View in Genome Browser
Species Human (GRCh38)
Location 9:135402883-135402905
Sequence GCCCTCGGTGGCCGGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218674_1062218681 -10 Left 1062218674 9:135402883-135402905 CCTCAACACCGGCCACCGAGGGC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG No data
1062218674_1062218683 -7 Left 1062218674 9:135402883-135402905 CCTCAACACCGGCCACCGAGGGC No data
Right 1062218683 9:135402899-135402921 CGAGGGCCCTGGGGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218674 Original CRISPR GCCCTCGGTGGCCGGTGTTG AGG (reversed) Intergenic