ID: 1062218680

View in Genome Browser
Species Human (GRCh38)
Location 9:135402895-135402917
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 466}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218660_1062218680 23 Left 1062218660 9:135402849-135402871 CCCACCCTCCGTGCCTCCTCCAG No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218659_1062218680 28 Left 1062218659 9:135402844-135402866 CCTCTCCCACCCTCCGTGCCTCC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218667_1062218680 4 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218662_1062218680 19 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218666_1062218680 7 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218668_1062218680 0 Left 1062218668 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218672_1062218680 -10 Left 1062218672 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218658_1062218680 29 Left 1062218658 9:135402843-135402865 CCCTCTCCCACCCTCCGTGCCTC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218670_1062218680 -3 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218665_1062218680 10 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218664_1062218680 15 Left 1062218664 9:135402857-135402879 CCGTGCCTCCTCCAGCCTCCATC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218663_1062218680 18 Left 1062218663 9:135402854-135402876 CCTCCGTGCCTCCTCCAGCCTCC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466
1062218661_1062218680 22 Left 1062218661 9:135402850-135402872 CCACCCTCCGTGCCTCCTCCAGC No data
Right 1062218680 9:135402895-135402917 CCACCGAGGGCCCTGGGGCCAGG 0: 1
1: 1
2: 2
3: 54
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218680 Original CRISPR CCACCGAGGGCCCTGGGGCC AGG Intergenic