ID: 1062218681

View in Genome Browser
Species Human (GRCh38)
Location 9:135402896-135402918
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 343}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062218672_1062218681 -9 Left 1062218672 9:135402882-135402904 CCCTCAACACCGGCCACCGAGGG No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218661_1062218681 23 Left 1062218661 9:135402850-135402872 CCACCCTCCGTGCCTCCTCCAGC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218668_1062218681 1 Left 1062218668 9:135402872-135402894 CCTCCATCAGCCCTCAACACCGG No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218666_1062218681 8 Left 1062218666 9:135402865-135402887 CCTCCAGCCTCCATCAGCCCTCA No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218658_1062218681 30 Left 1062218658 9:135402843-135402865 CCCTCTCCCACCCTCCGTGCCTC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218659_1062218681 29 Left 1062218659 9:135402844-135402866 CCTCTCCCACCCTCCGTGCCTCC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218670_1062218681 -2 Left 1062218670 9:135402875-135402897 CCATCAGCCCTCAACACCGGCCA No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218664_1062218681 16 Left 1062218664 9:135402857-135402879 CCGTGCCTCCTCCAGCCTCCATC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218665_1062218681 11 Left 1062218665 9:135402862-135402884 CCTCCTCCAGCCTCCATCAGCCC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218667_1062218681 5 Left 1062218667 9:135402868-135402890 CCAGCCTCCATCAGCCCTCAACA No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218674_1062218681 -10 Left 1062218674 9:135402883-135402905 CCTCAACACCGGCCACCGAGGGC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218663_1062218681 19 Left 1062218663 9:135402854-135402876 CCTCCGTGCCTCCTCCAGCCTCC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218660_1062218681 24 Left 1062218660 9:135402849-135402871 CCCACCCTCCGTGCCTCCTCCAG No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343
1062218662_1062218681 20 Left 1062218662 9:135402853-135402875 CCCTCCGTGCCTCCTCCAGCCTC No data
Right 1062218681 9:135402896-135402918 CACCGAGGGCCCTGGGGCCAGGG 0: 1
1: 0
2: 1
3: 49
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062218681 Original CRISPR CACCGAGGGCCCTGGGGCCA GGG Intergenic