ID: 1062219093

View in Genome Browser
Species Human (GRCh38)
Location 9:135404705-135404727
Sequence ACAAATCCCCAGGGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062219093_1062219100 4 Left 1062219093 9:135404705-135404727 CCCTCCACTCCCTGGGGATTTGT No data
Right 1062219100 9:135404732-135404754 TCAAGAGCTTCCCTTCTGCAGGG No data
1062219093_1062219102 9 Left 1062219093 9:135404705-135404727 CCCTCCACTCCCTGGGGATTTGT No data
Right 1062219102 9:135404737-135404759 AGCTTCCCTTCTGCAGGGGTTGG No data
1062219093_1062219099 3 Left 1062219093 9:135404705-135404727 CCCTCCACTCCCTGGGGATTTGT No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219093_1062219101 5 Left 1062219093 9:135404705-135404727 CCCTCCACTCCCTGGGGATTTGT No data
Right 1062219101 9:135404733-135404755 CAAGAGCTTCCCTTCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062219093 Original CRISPR ACAAATCCCCAGGGAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr