ID: 1062219099

View in Genome Browser
Species Human (GRCh38)
Location 9:135404731-135404753
Sequence CTCAAGAGCTTCCCTTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062219091_1062219099 9 Left 1062219091 9:135404699-135404721 CCAACACCCTCCACTCCCTGGGG No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219097_1062219099 -7 Left 1062219097 9:135404715-135404737 CCTGGGGATTTGTGTCCTCAAGA No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219088_1062219099 19 Left 1062219088 9:135404689-135404711 CCAGGAGGAGCCAACACCCTCCA No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219096_1062219099 -6 Left 1062219096 9:135404714-135404736 CCCTGGGGATTTGTGTCCTCAAG No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219093_1062219099 3 Left 1062219093 9:135404705-135404727 CCCTCCACTCCCTGGGGATTTGT No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219095_1062219099 -1 Left 1062219095 9:135404709-135404731 CCACTCCCTGGGGATTTGTGTCC No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data
1062219094_1062219099 2 Left 1062219094 9:135404706-135404728 CCTCCACTCCCTGGGGATTTGTG No data
Right 1062219099 9:135404731-135404753 CTCAAGAGCTTCCCTTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062219099 Original CRISPR CTCAAGAGCTTCCCTTCTGC AGG Intergenic
No off target data available for this crispr