ID: 1062219337

View in Genome Browser
Species Human (GRCh38)
Location 9:135406016-135406038
Sequence CCCTCCTGGCACTAGCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062219337_1062219343 13 Left 1062219337 9:135406016-135406038 CCATCAAGCTAGTGCCAGGAGGG No data
Right 1062219343 9:135406052-135406074 GATTGTCTCTTAGACTGAATGGG No data
1062219337_1062219344 14 Left 1062219337 9:135406016-135406038 CCATCAAGCTAGTGCCAGGAGGG No data
Right 1062219344 9:135406053-135406075 ATTGTCTCTTAGACTGAATGGGG No data
1062219337_1062219342 12 Left 1062219337 9:135406016-135406038 CCATCAAGCTAGTGCCAGGAGGG No data
Right 1062219342 9:135406051-135406073 TGATTGTCTCTTAGACTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062219337 Original CRISPR CCCTCCTGGCACTAGCTTGA TGG (reversed) Intergenic
No off target data available for this crispr