ID: 1062219478

View in Genome Browser
Species Human (GRCh38)
Location 9:135406927-135406949
Sequence TGGTGGGGAAGGCAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062219478_1062219489 16 Left 1062219478 9:135406927-135406949 CCATCCTCCTGCCTTCCCCACCA No data
Right 1062219489 9:135406966-135406988 AGCCTGAATTCCATGCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062219478 Original CRISPR TGGTGGGGAAGGCAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr