ID: 1062221731

View in Genome Browser
Species Human (GRCh38)
Location 9:135419682-135419704
Sequence CTTGATGCCCAGTAGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062221731_1062221735 -6 Left 1062221731 9:135419682-135419704 CCGGCTCCCTACTGGGCATCAAG No data
Right 1062221735 9:135419699-135419721 ATCAAGGAGTTTGACAACCCAGG No data
1062221731_1062221737 2 Left 1062221731 9:135419682-135419704 CCGGCTCCCTACTGGGCATCAAG No data
Right 1062221737 9:135419707-135419729 GTTTGACAACCCAGGCAGATGGG No data
1062221731_1062221736 1 Left 1062221731 9:135419682-135419704 CCGGCTCCCTACTGGGCATCAAG No data
Right 1062221736 9:135419706-135419728 AGTTTGACAACCCAGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062221731 Original CRISPR CTTGATGCCCAGTAGGGAGC CGG (reversed) Intergenic
No off target data available for this crispr